This is cutadapt 4.4 with Python 3.9.18
Command line parameters: --minimum-length=20 --max-n 0.1 --quality-cutoff 30,30 --output=/home/jforment/biovice/internal_projects/230904_antserra_chipseq/01-cleandata/BP.3.R1.clean.fq.gz --cores 50 --adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA BP.3.1.fq.gz
Processing single-end reads on 50 cores ...
Finished in 50.451 s (2.000 µs/read; 30.00 M reads/minute).

=== Summary ===

Total reads processed:              25,227,438
Reads with adapters:                   660,281 (2.6%)

== Read fate breakdown ==
Reads that were too short:             237,740 (0.9%)
Reads with too many N:                       0 (0.0%)
Reads written (passing filters):    24,989,698 (99.1%)

Total basepairs processed: 1,261,371,900 bp
Quality-trimmed:              15,632,301 bp (1.2%)
Total written (filtered):  1,242,064,420 bp (98.5%)

=== Adapter 1 ===

Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA; Type: regular 3'; Length: 33; Trimmed: 660281 times

Minimum overlap: 3
No. of allowed errors:
1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-33 bp: 3

Bases preceding removed adapters:
  A: 36.3%
  C: 20.2%
  G: 25.3%
  T: 18.2%
  none/other: 0.1%

Overview of removed sequences
length	count	expect	max.err	error counts
3	497624	394178.7	0	497624
4	124672	98544.7	0	124672
5	27963	24636.2	0	27963
6	5946	6159.0	0	5946
7	1699	1539.8	0	1699
8	238	384.9	0	238
9	654	96.2	0	80 574
10	801	24.1	1	16 785
11	417	6.0	1	4 413
12	126	1.5	1	1 125
13	39	0.4	1	0 39
14	9	0.1	1	0 9
15	3	0.0	1	0 3
16	5	0.0	1	1 4
39	1	0.0	3	1
40	18	0.0	3	1 15 2
41	1	0.0	3	0 1
42	1	0.0	3	1
44	5	0.0	3	4 1
46	1	0.0	3	1
47	1	0.0	3	0 1
48	1	0.0	3	0 0 1
50	56	0.0	3	6 41 7 2