This is cutadapt 4.4 with Python 3.9.18
Command line parameters: --minimum-length=20 --max-n 0.1 --quality-cutoff 30,30 --output=/home/jforment/biovice/internal_projects/230904_antserra_chipseq/01-cleandata/Col.1.R1.clean.fq.gz --cores 50 --adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Col.1.1.fq.gz
Processing single-end reads on 50 cores ...
Finished in 48.593 s (1.977 µs/read; 30.35 M reads/minute).

=== Summary ===

Total reads processed:              24,581,520
Reads with adapters:                   628,784 (2.6%)

== Read fate breakdown ==
Reads that were too short:             263,687 (1.1%)
Reads with too many N:                       0 (0.0%)
Reads written (passing filters):    24,317,833 (98.9%)

Total basepairs processed: 1,229,076,000 bp
Quality-trimmed:              17,494,460 bp (1.4%)
Total written (filtered):  1,207,830,815 bp (98.3%)

=== Adapter 1 ===

Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA; Type: regular 3'; Length: 33; Trimmed: 628784 times

Minimum overlap: 3
No. of allowed errors:
1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-33 bp: 3

Bases preceding removed adapters:
  A: 37.3%
  C: 20.0%
  G: 24.9%
  T: 17.8%
  none/other: 0.1%

Overview of removed sequences
length	count	expect	max.err	error counts
3	472806	384086.2	0	472806
4	117786	96021.6	0	117786
5	27473	24005.4	0	27473
6	6502	6001.3	0	6502
7	2074	1500.3	0	2074
8	254	375.1	0	254
9	631	93.8	0	88 543
10	741	23.4	1	14 727
11	371	5.9	1	5 366
12	100	1.5	1	1 99
13	26	0.4	1	0 26
14	4	0.1	1	0 4
40	9	0.0	3	1 7 0 1
50	7	0.0	3	0 6 1