This is cutadapt 4.4 with Python 3.9.18
Command line parameters: --minimum-length=20 --max-n 0.1 --quality-cutoff 30,30 --output=/home/jforment/biovice/internal_projects/230904_antserra_chipseq/01-cleandata/Col.2.R1.clean.fq.gz --cores 50 --adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Col.2.1.fq.gz
Processing single-end reads on 50 cores ...
Finished in 41.141 s (1.936 µs/read; 30.99 M reads/minute).

=== Summary ===

Total reads processed:              21,252,268
Reads with adapters:                   519,004 (2.4%)

== Read fate breakdown ==
Reads that were too short:             402,965 (1.9%)
Reads with too many N:                       0 (0.0%)
Reads written (passing filters):    20,849,303 (98.1%)

Total basepairs processed: 1,062,613,400 bp
Quality-trimmed:              25,595,901 bp (2.4%)
Total written (filtered):  1,033,039,296 bp (97.2%)

=== Adapter 1 ===

Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA; Type: regular 3'; Length: 33; Trimmed: 519004 times

Minimum overlap: 3
No. of allowed errors:
1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-33 bp: 3

Bases preceding removed adapters:
  A: 35.9%
  C: 20.8%
  G: 25.1%
  T: 17.9%
  none/other: 0.2%

Overview of removed sequences
length	count	expect	max.err	error counts
3	388137	332066.7	0	388137
4	97955	83016.7	0	97955
5	23397	20754.2	0	23397
6	5921	5188.5	0	5921
7	1733	1297.1	0	1733
8	159	324.3	0	159
9	525	81.1	0	52 473
10	671	20.3	1	21 650
11	330	5.1	1	4 326
12	108	1.3	1	3 105
13	28	0.3	1	0 28
14	9	0.1	1	0 9
15	1	0.0	1	0 1
16	1	0.0	1	0 1
40	2	0.0	3	1 1
49	3	0.0	3	0 0 3
50	24	0.0	3	6 12 5 1