This is cutadapt 4.4 with Python 3.9.18
Command line parameters: --minimum-length=20 --max-n 0.1 --quality-cutoff 30,30 --output=/home/jforment/biovice/internal_projects/230904_antserra_chipseq/01-cleandata/Col.3.R1.clean.fq.gz --cores 50 --adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Col.3.1.fq.gz
Processing single-end reads on 50 cores ...
Finished in 35.357 s (1.859 µs/read; 32.27 M reads/minute).

=== Summary ===

Total reads processed:              19,016,858
Reads with adapters:                   480,423 (2.5%)

== Read fate breakdown ==
Reads that were too short:             509,205 (2.7%)
Reads with too many N:                       0 (0.0%)
Reads written (passing filters):    18,507,653 (97.3%)

Total basepairs processed:   950,842,900 bp
Quality-trimmed:              32,066,594 bp (3.4%)
Total written (filtered):    914,341,359 bp (96.2%)

=== Adapter 1 ===

Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA; Type: regular 3'; Length: 33; Trimmed: 480423 times

Minimum overlap: 3
No. of allowed errors:
1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-33 bp: 3

Bases preceding removed adapters:
  A: 39.0%
  C: 17.9%
  G: 24.2%
  T: 18.6%
  none/other: 0.3%

Overview of removed sequences
length	count	expect	max.err	error counts
3	354077	297138.4	0	354077
4	89367	74284.6	0	89367
5	23790	18571.2	0	23790
6	5094	4642.8	0	5094
7	1815	1160.7	0	1815
8	242	290.2	0	242
9	508	72.5	0	89 419
10	745	18.1	1	104 641
11	462	4.5	1	139 323
12	2508	1.1	1	2282 226
13	306	0.3	1	229 77
14	927	0.1	1	0 927
15	7	0.0	1	3 4
19	1	0.0	1	0 1
30	1	0.0	3	0 0 1
32	2	0.0	3	0 2
35	2	0.0	3	0 1 0 1
38	6	0.0	3	0 5 1
39	29	0.0	3	0 24 4 1
40	459	0.0	3	10 408 36 5
41	11	0.0	3	0 8 3
42	3	0.0	3	0 0 1 2
45	1	0.0	3	0 1
46	2	0.0	3	0 2
47	1	0.0	3	0 0 1
48	2	0.0	3	0 2
49	5	0.0	3	1 3 0 1
50	50	0.0	3	5 35 10